nirfriedmanlab.blogspot.com
The Friedman Lab ChroniclesStarting a new lab in the middle of a research career
http://nirfriedmanlab.blogspot.com/
Starting a new lab in the middle of a research career
http://nirfriedmanlab.blogspot.com/
TODAY'S RATING
>1,000,000
Date Range
HIGHEST TRAFFIC ON
Saturday
LOAD TIME
0.5 seconds
16x16
32x32
PAGES IN
THIS WEBSITE
19
SSL
EXTERNAL LINKS
11
SITE IP
172.217.3.97
LOAD TIME
0.469 sec
SCORE
6.2
The Friedman Lab Chronicles | nirfriedmanlab.blogspot.com Reviews
https://nirfriedmanlab.blogspot.com
Starting a new lab in the middle of a research career
The Friedman Lab Chronicles: July 2012
http://nirfriedmanlab.blogspot.com/2012_07_01_archive.html
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Tuesday, July 31, 2012. Systematic Dissection of Roles for Chromatin Regulators in a Yeast Stress Response. The monster is out! A work that started more than 2 years ago, finally resulted in a publication. The paper. Came out in PLoS Biology. This publication is also the first time we publish experimental work done in our own lab. We can say that we are officially an experimental lab! Links to this post. And so we found o...
The Friedman Lab Chronicles: Light box
http://nirfriedmanlab.blogspot.com/2012/08/light-box.html
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Friday, August 24, 2012. As you may recall from early posts, we use agar plates for growing. Libraries of yeast strains. We also keep "replicating" copies of these plates to maintain a "live" copy of the libraries. Instead we aimed for a dedicated station for imaging plates. We found some solutions by commercial companies. These however, were very very expensive. And so we decided for a Do It Yourself solution...I wrote a...
The Friedman Lab Chronicles: March 2011
http://nirfriedmanlab.blogspot.com/2011_03_01_archive.html
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Wednesday, March 30, 2011. Exploring transcription regulation through cell-to-cell variability. A paper that was in the works for two years, including more than six months in review, finally appeared in Proceedings of National Academy of Sciences, USA. Links to this post. Tuesday, March 22, 2011. Part of learning to program a complex robot involves learning to debug programs that actually manipulate the real world. As...
The Friedman Lab Chronicles: June 2011
http://nirfriedmanlab.blogspot.com/2011_06_01_archive.html
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Wednesday, June 29, 2011. Substantial Histone Reduction Modulates Genome-wide Nucleosomal Occupancy and Global Transcriptional Output. The recent wave of publications seem to continue, and a nother paper just appeared in PLoS Biology. Like the previous one. This one was in the reviewing rounds for very long, and so we are very happy that it finally appeared. Source: PLoS Biology Synopsis by Robin Mejia. Links to this post.
The Friedman Lab Chronicles: February 2011
http://nirfriedmanlab.blogspot.com/2011_02_01_archive.html
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Wednesday, February 23, 2011. Our group is part of a consortium that is funded by the European Union for a joint project on transcriptional regulation in inflammatory response. The title of the project is MODEL-IN, and you can learn more about it in its website. We spent two intensive days in meetings going over scientific results. Links to this post. Monday, February 21, 2011. Described), then the robot stimulated them a...
TOTAL PAGES IN THIS WEBSITE
19
perl random number nomal distributation using matlab | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2012/03/25/perl-random-number-nomal-distributation-using-matlab
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. GFF3 file used in TopHat and Cufflink. BWA is more sensentive than Bowtie? Perl random number nomal distributation using matlab. March 25, 2012. 8212;—————————————————–. This is a matlab script. Rn=round(random(‘normal’,256,512,1000000,1) ;. Rn(find(rn 64) =[];. Rn(find(rn 1024) =[];. Fid=fopen(`myfile.txt`,’w’);. Fprintf(fid,’%d n’,rn);. Matlab -nodesktop -nosplash -nojvm -r “run ./$FileName;quit;”. View all posts by Rocky →.
Groupwise association test for rare variants | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2011/07/18/groupwise-association-test-for-rare-variants
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Craig J. Venter’s Talk on synthetic Biology →. Groupwise association test for rare variants. July 18, 2011. Http:/ genetics.cs.ucla.edu/rarevariants/. Groupwise Association Test for Rare Variants. Madsen BE, Browning SR (2009). A Groupwise Association Test for Rare Mutations Using a Weighted Sum Statistic. PLoS Genet 5(2): e1000384. Association studies for next-generation sequencing. Li Luo, Eric Boerwinkle, and Momiao Xiong.
BWA is more sensentive than Bowtie? | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2012/03/31/bwa-is-more-sensentive-than-bowtie
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Perl random number nomal distributation using matlab. BWA is more sensentive than Bowtie? March 31, 2012. I tried various parameters to map this paired-end reads to hg19 using bowtie, but failed. BWA can map this paired end reads to hg19 correctly. A researcher in Bioinformatics and Computational Biology. View all posts by Rocky →. This entry was posted in Bioinformatics Tools. And tagged bwa bowtie sensitivity. Enter your comment here.
stuctural variation detection algorithms | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2011/08/20/stuctural-variation-detection-algorithms
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Craig J. Venter’s Talk on synthetic Biology. GFF3 file used in TopHat and Cufflink →. Stuctural variation detection algorithms. August 20, 2011. AGE: defining breakpoints of genomic structural variants at single-nucleotide resolution, through optimal alignments with gap excision, Bioinformatics,Volume27, Issue5, Pp. 595-603. A researcher in Bioinformatics and Computational Biology. View all posts by Rocky →. Leave a Reply Cancel reply.
Rocky | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/author/hrbrocky
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. A researcher in Bioinformatics and Computational Biology. BWA is more sensentive than Bowtie? March 31, 2012. Read/1 CATTACCCCAACTAAACATACAAACTGCTTACAGATTTGCTGAAATTGTC read/2 TGTGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGA I tried various parameters to map this paired-end reads to hg19 using bowtie, but failed. BWA can map this paired end reads to hg19 correctly. Perl random number nomal distributation using matlab. March 25, 2012.
Yongjin's Bioinformatics Blog | Notes and thoughts in Bioinformatics. | Page 2
https://hrbrocky.wordpress.com/page/2
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Newer posts →. June 19, 2011. Genome-wide strategies for detecting multiple loci that influence complex diseases, Nature Genetics 37, 413 – 417 (2005) http:/ www.nature.com/ng/journal/v37/n4/abs/ng1537.html. Finding the missing heritability of complex diseases, Nature 461, 747-753 (8 October 2009). Http:/ www.nature.com/nature/journal/v461/n7265/abs/nature08494.html. February 25, 2011. Sed 是很有用 但常被遗忘 的 UNIX 流编辑器。 本文是 前一篇介绍 sed 文章. Sed -...
RNA-Seq Tools | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2011/07/02/rna-seq-tools
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Groupwise association test for rare variants →. July 2, 2011. A pipeline for RNA-seq data processing and quality assessment. Http:/ info.gersteinlab.org/RSEQtools. A researcher in Bioinformatics and Computational Biology. View all posts by Rocky →. This entry was posted in Cancer. Groupwise association test for rare variants →. Leave a Reply Cancel reply. Enter your comment here. Fill in your details below or click an icon to log in:.
Nir Friedman
http://www.cs.huji.ac.il/~nir
The Rachel and Selim Benin School of Computer Science and Engineering. The Alexander Silberman Institute of Life Sciences. The Hebrew University of Jerusalem. Nir@cs.huji.ac.il. I am a faculty member of the School of Computer Science and Engineering. I am a faculty member of the Department of Biological Chemistry. At the Alexander Silberan Institute of Life Sciences. My own research group. Computer Science: B532 Rothberg Building. Life Sciences: 3-213 Silberman Building. Office hours: by appointment.
GFF3 file used in TopHat and Cufflink | Yongjin's Bioinformatics Blog
https://hrbrocky.wordpress.com/2012/02/20/gff3-file-used-in-tophat-and-cufflink
Yongjin's Bioinformatics Blog. Notes and thoughts in Bioinformatics. Stuctural variation detection algorithms. Perl random number nomal distributation using matlab →. GFF3 file used in TopHat and Cufflink. February 20, 2012. Here is the description of GFF3 file format. Http:/ www.sequenceontology.org/resources/gff3.html. The GFF3 file for human can be downloaded from MPG website. Http:/ galaxy.fml.mpg.de/library common/browse library? Http:/ www.sequenceontology.org/resources/databases.html. Michael Zhan...
TOTAL LINKS TO THIS WEBSITE
11
nirfralemastoulousaam.blogspot.com
Our Construction With Mas Toulousain
Our Construction With Mas Toulousain. Friday, March 4, 2011. New exhibit: The Natural. Ten adherent of Font Designers. Exhibit at the rendezvous of Natural Montmorency (95), 25, 26 and 27 March 2011 in partnership with the collective creative Boiling. The Natural welcome craftspeople, designers, regional products, farm animals, throughout the weekend at Park Hall Ville.Des creative workshops will take place on site - registration with the Office of Tourism Montmorency: 01.39.34.95.28.
NIRFRID | Seguridad & Limpieza
Nir's blog · Fit for computer consumption
Code, math, and all that good stuff. Fit for computer consumption. Writing Good C By Default, in the STL. Posted on January 18, 2016. If you haven’t seen Herb Sutter’s recent talk at CppCon 2015 Writing Good C by Default , you should. It’s a great talk that largely discusses static analysis and various types of safety. In particular, he discusses lifetime safety: the risk that objects, particularly non-owning views such as references, pointers,. [Read More]. Posted on October 4, 2015. Sometimes in C , an...
nirfriedman.org - nirfriedman Resources and Information.
This page provided to the domain owner free. By Sedo's Domain Parking. Disclaimer: Domain owner and Sedo maintain no relationship with third party advertisers. Reference to any specific service or trade mark is not controlled by Sedo or domain owner and does not constitute or imply its association, endorsement or recommendation.
The Friedman Lab Chronicles
The Friedman Lab Chronicles. Starting a new lab in the middle of a research career. Tuesday, October 23, 2012. A functional selection model explains evolutionary robustness despite plasticity in regulatory networks. Its out on the Molecular Systems Biology website. This paper summarizes quite a bit of work by Naomi and Ilan. It started with "here is a short 2-week project" and ended as big part of Naomi's PHD and a massive paper. Highlights (from our synopsis):. The vast majority of cis. It seems that we...
nirfx | graphics . photography . mac support
Welcome to my site. This site is still growing, so keep visiting .
The domain name NIRG.COM.
The domain name NIRG.COM is for sale. Get On The Web Limited some years ago registered for its websites, portals and client projects a number of generic domain names (including this one), which are now no longer required. We are offering for sale the domain name NIRG.COM. If you are interested in the 4-letter acronym NIRG and would like to purchase the domain name NIRG.COM please complete this offer form. Why choose a 4-letter acronym like NIRG for your business?
Three.Fourteen
Welcome to Three.Fourteen. Website and blog by Nir Grinberg. When Do People Expect More Likes and Comments on Facebook and From Whom? February 24, 2017. Despite the fact that social media has been around for over a decade now, we still know reletively little about people's expectations for getting attention and responses from their online friends. In this work. We examine the often overlooked end of the attention ` transaction' : the content producer's expectation . January 10, 2016. February 28, 2014.
Narrative Identity Research Group
Narrative Identity Research Group. Skip to primary content. The Narrative and Identity Research Group (NIRG) at UCSC. Narrative theory and methods have a long history at UC Santa Cruz. Social psychologist and early faculty member Ted Sarbin was one of the pioneer promoters of narrative psychology in the 1980s, with his landmark volume. Narrative Psychology: The Storied Nature of Human Conduct. For questions about NIRG or to be added to the NIRG email announcement list, please contact Erin Toolis ( eetool...
Nir Gabizon LTD